T-box Riboswitch Annotation Database - TBDB - UQCD7JYG from

T-box riboswitch UQCD7JYG

Putative ASN (GUU) T-box riboswitch from Bacillus licheniformis

Source information

TBDB ID	UQCD7JYG
Host organism	Bacillus licheniformis
Model used	Class I
Predicted regulation	Transcriptional
T-box riboswitch genomic accession	CP045814.1:2902393-2902134
Downstream protein description	histidine--tRNA ligase
Downstream protein ID	GenBank: QGI44433.1
T-box riboswitch length
Specifier loop sequence	GAACA
T-box 5'-UGGN-3' sequence	UGGC
Predicted specifier	AAC
Predicted tRNA family	ASN (GUU)
Found cognate tRNA	True
Alternative specifiers	None
Metagenome	False
Structural predictions	Full

Genomic Context

Error loading NCBI Genome Browser - Cookies disabled To use the NCBI genome browser for visualizing genetic context of T-box riboswitch sequences, please enable cookies on your web browser.

Full T-box riboswitch FASTA sequence

>T-box Riboswitch Sequence UQCD7JYG GATGGAGAATAGTAGGCAAGAGTACGTGAAAAGAGAGGAACCGCCCTGGGCTGAAAGCGGTCTGCACGGTATCTTGACCGAATGAACACTCCGAAGGTTTCCCGCTGAAAGCCCGGCATAACATGCGAGCAATTAGGCGGCGGACGTGAACCTGCGTTAAAGGCATGAGCGGGAACGGATTTATCGTTCCAACTAGGGTGGCACCACGGGTATAACTCTCGTCCCTACTATTGGTTTTATAGTAGATTCGGGGGTTTTTT

Predicted secondary structures

T-box riboswitch UQCD7JYG Antiterminator ..(((((.......((((((.....(((...........(((((............)))))...))).....)))).)).........))))...)...(((((((.............................))))).)).(((......)))...............(((((((.....)))))))....((((.......(((((.......)))))))))..................................

T-box riboswitch UQCD7JYG Terminator ..(((((.......((((((.....(((...........(((((............)))))...))).....)))).)).........))))...)...(((((((.............................))))).)).(((......)))...............(((((((.....))))))).........................((((((...(((((((.......)))))))...))))))......

Specifier and tRNA predictions

Top specifier

Top predicted specifier: AAC
Top predicted tRNA family: ASN (GUU)

Best tRNA match for top specifier >ASN (GUU) tRNA from Bacillus licheniformis
TCCGCAGTAGCTCAGTGGTAGAGCTATCGGCTGTTAACCGATCGGTCGCAGGTTCGAATCCTGCCTGCGGAGCCA

Predicted tRNA structure (((((((..((((.......)))).(((((.......))))).....(((((.......))))))))))))....

Alternative specifier 1

Alternative 1 for predicted specifier: -
Alternative 1 for predicted tRNA family: -

Best tRNA match for alternative specifier 1 >TBDB tRNA pairing failed
tRNAscan-SE failed to find tRNA in host organism with anticodon matching predicted T-box specifier.

Predicted tRNA structure No tRNA structure predicted.

Alternative specifier 2

Alternative 2 for predicted specifier: -
Alternative 2 for predicted tRNA family: -

Best tRNA match for alternative specifier 2 >TBDB tRNA pairing failed
tRNAscan-SE failed to find tRNA in host organism with anticodon matching predicted T-box specifier.

Predicted tRNA structure No tRNA structure predicted.

Minimum Free Energy (MFE) Calculations

Folding MFE predictions

Antiterminator	ΔG° (kcal/mol)	-7.6
Terminator	ΔG° (kcal/mol	-14.3
	ΔΔG° (kcal/mol)

*Calculations performed using Vienna RNAeval at 37°C. More information available on methods avaialble on BioRXIV.

INFERNAL T-box riboswitch prediction output

Infernal prediction values

E-Value
Score	82.4
Bias	0.0
CM Accuracy	0.94

*More information about the meaning of these values can be found here.

T-box riboswitch structure prediction from input sequence

Feature	Length	Locus
Stem I		[2,97]
Stem II region
Stem III
Specifier region	-	[84,86]
T-box UGGN locus	-	[199,202]
Antiterminator		[195,226]
Terminator		[216,260]
All stems	-	[[2, 97], [100, 143], [145, 156], [172, 190], [195, 226]]

Input source sequence >CP045814.1:2902393-2902134
GATGGAGAATAGTAGGCAAGAGTACGTGAAAAGAGAGGAACCGCCCTGGGCTGAAAGCGGTCTGCACGGTATCTTGACCGAATGAACACTCCGAAGGTTTCCCGCTGAAAGCCCGGCATAACATGCGAGCAATTAGGCGGCGGACGTGAACCTGCGTTAAAGGCATGAGCGGGAACGGATTTATCGTTCCAACTAGGGTGGCACCACGGGTATAACTCTCGTCCCTACTATTGGTTTTATAGTAGATTCGGGGGTTTTTT

INFERNAL output sequence >Infernal-CP045814.1:2902393-2902134
G-----AU------GGAGAAUAGUAGGCAAGAG--UACGUGAAAAGAGAggAACCGCCCUGgGCUGAAAGCGGUCugCACGGUAUCUUGaCCGAAUgAACACUCCGAAGGUUUCCCGCUGAAAgcccggcauaacaugcGAGCAAUUAGGCGGcGGACGUGAACCUGCGUUA----AAGGCAUGAGCGGGAACGG---AUUUAUCGUUCCAACUAGGGUGGCACCACGGGUAUAAcUCUCGUCCCUACU

INFERNAL output structure - (Antiterminator) >Infernal-Structure-CP045814.1:2902393-2902134
::::::<<------<<<<-------<<<<<<-------<<<--------..<<<<<<____._______>>>>>>..>>>----->>>>.>>----.---->>>>--->>,,<<<<<<<____................_________>>>>>.>>,<<<______>>>,,,,,,,,,,,,,,,,,,,<<<<<<<________>>>>>>>,,,,<<<<-------<<<<<_____._>>>>>>>>>:::