T-box Riboswitch Annotation Database - TBDB - TRLFHUW4 from

T-box riboswitch TRLFHUW4

Putative LEU (GAG) T-box riboswitch from Lachnoclostridium sp. YL32

Source information

TBDB ID	TRLFHUW4
Host organism	Lachnoclostridium sp. YL32
Model used	Class I
Predicted regulation	Unknown
T-box riboswitch genomic accession	CP015399.2:296447-296090
Downstream protein description	carbon starvation protein A
Downstream protein ID	GenBank: ANU44583.2
T-box riboswitch length
Specifier loop sequence	CCUCA
T-box 5'-UGGN-3' sequence	-
Predicted specifier	CUC
Predicted tRNA family	LEU (GAG)
Found cognate tRNA	False
Alternative specifiers	None
Metagenome	False
Structural predictions	Partial

Genomic Context

Error loading NCBI Genome Browser - Cookies disabled To use the NCBI genome browser for visualizing genetic context of T-box riboswitch sequences, please enable cookies on your web browser.

Full T-box riboswitch FASTA sequence

>T-box Riboswitch Sequence TRLFHUW4 AGAAAAGCAATGACTGGGACATGTCATGGTTTCAGATTCCGGCACAGAGAGCAGCCCGGCTGGTGGAAGGGCGCGCGCGAGGAATCATGGCCTCACCCAACAGCTTCTGTTCTGGACCCCTTTCCTGAGAGGGAGGATAGTAGGGATGGACGGGTTTCTTTCCGTTAACAAAGCTACTTTATATATGTGAGGAGACTTGATGATGAATGGTTTAGTGATGATGCTTTTAGCCGTAGTGGTATTAGGCGG

Predicted secondary structures

T-box riboswitch TRLFHUW4 Antiterminator Error: TBDB structure refinement failed to predict a reasonable antiterminator structure for this T-box.

T-box riboswitch TRLFHUW4 Terminator Error: TBDB structure refinement failed to predict a terminator structure for this T-box

Specifier and tRNA predictions

Top specifier

Top predicted specifier: CUC
Top predicted tRNA family: LEU (GAG)

Best tRNA match for top specifier >TBDB tRNA pairing failed
tRNAscan-SE failed to find tRNA in host organism with anticodon matching predicted T-box specifier.

Predicted tRNA structure No tRNA structure predicted.

Alternative specifier 1

Alternative 1 for predicted specifier: -
Alternative 1 for predicted tRNA family: -

Best tRNA match for alternative specifier 1 >TBDB tRNA pairing failed
tRNAscan-SE failed to find tRNA in host organism with anticodon matching predicted T-box specifier.

Predicted tRNA structure No tRNA structure predicted.

Alternative specifier 2

Alternative 2 for predicted specifier: -
Alternative 2 for predicted tRNA family: -

Best tRNA match for alternative specifier 2 >TBDB tRNA pairing failed
tRNAscan-SE failed to find tRNA in host organism with anticodon matching predicted T-box specifier.

Predicted tRNA structure No tRNA structure predicted.

Minimum Free Energy (MFE) Calculations

Folding MFE predictions

Antiterminator	ΔG° (kcal/mol)	0.0
Terminator	ΔG° (kcal/mol	0.0
	ΔΔG° (kcal/mol)

*Calculations performed using Vienna RNAeval at 37°C. More information available on methods avaialble on BioRXIV.

INFERNAL T-box riboswitch prediction output

Infernal prediction values

E-Value
Score	46.1
Bias	0.0
CM Accuracy	0.94

*More information about the meaning of these values can be found here.

T-box riboswitch structure prediction from input sequence

Feature	Length	Locus
Stem I		[116,213]
Stem II region
Stem III
Specifier region	-	[200,202]
T-box UGGN locus	-	[0,2]
Antiterminator		[304,325]
Terminator		[346,358]
All stems	-	[[116, 213], [216, 258], [260, 273], [304, 325]]

Input source sequence >CP015399.2:296447-296090
CCTGTAGTTATGAACAATATATAAATAAAGTATAAAAAAAGTGTTAAAATATCATTGATTTCTCTGTATTAAAGTGTTAAACTTCTTGACATCAAGAGTTTGATACTTGAGAAAAGCAATGACTGGGACATGTCATGGTTTCAGATTCCGGCACAGAGAGCAGCCCGGCTGGTGGAAGGGCGCGCGCGAGGAATCATGGCCTCACCCAACAGCTTCTGTTCTGGACCCCTTTCCTGAGAGGGAGGATAGTAGGGATGGACGGGTTTCTTTCCGTTAACAAAGCTACTTTATATATGTGAGGAGACTTGATGATGAATGGTTTAGTGATGATGCTTTTAGCCGTAGTGGTATTAGGCGG

INFERNAL output sequence >Infernal-CP015399.2:296447-296090
AGAAAAGCAAUGACUGGGACAUGUCAUGGUUUCAgAUUCCGGCACAGAGAGCaGCCCGGCUGGUGGAAGGGCGCGCGCGAGGAAUCAUGGC-CUCACCCAACAGCUUCUGUUCUGGACcccuuuccugagagggAGGAUAGUAGGGAUGGACGGGUUUcuUUCCGUUAAcaaagcuacuuUAUAUAUGUGAGGAGACUUGAUGAUGAAUGGUUUAGUGAU*[ 6]*UUU

INFERNAL output structure - (Antiterminator) >Infernal-Structure-CP015399.2:296447-296090
::::::<<------<<<<-------<<<<<<---.----<<<--------<<.<<<<___________>>>>>>>>>----->>>>>>-------->>>>--->>,,<<<<<<<____................_________>>>>>>>,<<<____..__>>>,,,,...........,,,,,,,,,,,,,,,<<<<<<<________>>>>>>>,,,~~~~~~:::