T-box Riboswitch Annotation Database - TBDB - TQ4EVT2U from

T-box riboswitch TQ4EVT2U

Putative VAL (UAC) T-box riboswitch from Clostridium sp. CAG:451

Source information

TBDB ID	TQ4EVT2U
Host organism	Clostridium sp. CAG:451
Model used	Class I
Predicted regulation	Transcriptional
T-box riboswitch genomic accession	FR901052.1:17180-16925
Downstream protein description	valine--tRNA ligase
Downstream protein ID	ENA: CDE73616.1
T-box riboswitch length
Specifier loop sequence	GUAGC
T-box 5'-UGGN-3' sequence	UGGU
Predicted specifier	GUA
Predicted tRNA family	VAL (UAC)
Found cognate tRNA	True
Alternative specifiers	None
Metagenome	False
Structural predictions	Full

Genomic Context

Error loading NCBI Genome Browser - Cookies disabled To use the NCBI genome browser for visualizing genetic context of T-box riboswitch sequences, please enable cookies on your web browser.

Full T-box riboswitch FASTA sequence

>T-box Riboswitch Sequence TQ4EVT2U GTAAATACATTGACTGTTGAGGAGTACATATCATTTTATTTTTAGAGAGTTAAGGGTAGGTGAGACTTAACAATAAAAGATATGGAAGGTAGCAACAAGAGTAGGATTTCTGAAATAGTAGTAGGTTATCCCGGGAGAACCGTTAAATAAATAAGGTATGTTAAACATACAAATTAAGGTGGTACCACGAACTTCTCGTCCTTTGGATAGAGAAGTTTTTATTTTT

Predicted secondary structures

T-box riboswitch TQ4EVT2U Antiterminator ......((......((((........((((((.....(((........((((((...........)))))))))....)))))).........))))...))..(((..((............))..))).(((.....))).............((((((...)))))).....((((.......((((.....)))))))).......................

T-box riboswitch TQ4EVT2U Terminator ......((......((((........((((((.....(((........((((((...........)))))))))....)))))).........))))...))..(((..((............))..))).(((.....))).............((((((...)))))).....................((((((((((...)))).))))))...........

Specifier and tRNA predictions

Top specifier

Top predicted specifier: GUA
Top predicted tRNA family: VAL (UAC)

Best tRNA match for top specifier >VAL (UAC) tRNA from Clostridium sp. CAG:451
GGGCGATTAGCTCAGTTGGTTAGAGCACCTGCCTTACAAGCAGGGGGTCATAGGTTCGAGTCCTATATCGCCCACCA

Predicted tRNA structure (((((((..((((.........)))).(((((.......))))).....(((((.......))))))))))))....

Alternative specifier 1

Alternative 1 for predicted specifier: -
Alternative 1 for predicted tRNA family: -

Best tRNA match for alternative specifier 1 >TBDB tRNA pairing failed
tRNAscan-SE failed to find tRNA in host organism with anticodon matching predicted T-box specifier.

Predicted tRNA structure No tRNA structure predicted.

Alternative specifier 2

Alternative 2 for predicted specifier: -
Alternative 2 for predicted tRNA family: -

Best tRNA match for alternative specifier 2 >TBDB tRNA pairing failed
tRNAscan-SE failed to find tRNA in host organism with anticodon matching predicted T-box specifier.

Predicted tRNA structure No tRNA structure predicted.

Minimum Free Energy (MFE) Calculations

Folding MFE predictions

Antiterminator	ΔG° (kcal/mol)	-2.6
Terminator	ΔG° (kcal/mol	-10.3
	ΔΔG° (kcal/mol)

*Calculations performed using Vienna RNAeval at 37°C. More information available on methods avaialble on BioRXIV.

INFERNAL T-box riboswitch prediction output

Infernal prediction values

E-Value
Score	132.1
Bias	4.7
CM Accuracy	0.96

*More information about the meaning of these values can be found here.

T-box riboswitch structure prediction from input sequence

Feature	Length	Locus
Stem I		[7,102]
Stem II region
Stem III
Specifier region	-	[89,91]
T-box UGGN locus	-	[180,183]
Antiterminator		[176,203]
Terminator		[192,226]
All stems	-	[[7, 102], [105, 130], [132, 142], [156, 170], [176, 203]]

Input source sequence >FR901052.1:17180-16925
GTAAATACATTGACTGTTGAGGAGTACATATCATTTTATTTTTAGAGAGTTAAGGGTAGGTGAGACTTAACAATAAAAGATATGGAAGGTAGCAACAAGAGTAGGATTTCTGAAATAGTAGTAGGTTATCCCGGGAGAACCGTTAAATAAATAAGGTATGTTAAACATACAAATTAAGGTGGTACCACGAACTTCTCGTCCTTTGGATAGAGAAGTTTTTATTTTT

INFERNAL output sequence >Infernal-FR901052.1:17180-16925
GUAAAUACAUUGACUGUUgAGGAGUACAUAUCAU--UUUAUUUUUAGAGAGUUAAGGGUAGGUGAGACUUAACAAUAAA-AGAUAUGGAAGGUAGcAACAAGAGUAGGAUUUCUGAA-AUAGUAGUAGGUUAUCCCGGGAG-AACCGUUA------AAUAAAUAAGGUAUGUU-------AAACAUACAAAuUAAGGUGGUACCACGAA--CUU-CUCGUCCUUUGG

INFERNAL output structure - (Antiterminator) >Infernal-Structure-FR901052.1:17180-16925
::::::<<------<<<<.-------<<<<<<-------<<<--------<<<<<<___________>>>>>>>>>----->>>>>>--------.>>>>--->>,,<<<<<<<_____________>>>>>>>,<<<______>>>,,,,,,,,,,,,,,,,,,,<<<<<<<________>>>>>>>,,,.,<<<<-------<<<<<______>>>>>>>>>:::