T-box Riboswitch Annotation Database - TBDB - OP8LOG3 from

T-box riboswitch OP8LOG3

Putative ALA (AGC) T-box riboswitch from Lactobacillus reuteri TD1

Source information

TBDB ID	OP8LOG3
Host organism	Lactobacillus reuteri TD1
Model used	Class I
Predicted regulation	Transcriptional
T-box riboswitch genomic accession	CP006603.1:633639-633946
Downstream protein description	alanyl-tRNA synthase
Downstream protein ID	GenBank: AGR63961.1
T-box riboswitch length
Specifier loop sequence	UGCUC
T-box 5'-UGGN-3' sequence	UGGU
Predicted specifier	GCU
Predicted tRNA family	ALA (AGC)
Found cognate tRNA	False
Alternative specifiers	None
Metagenome	False
Structural predictions	Full

Genomic Context

Error loading NCBI Genome Browser - Cookies disabled To use the NCBI genome browser for visualizing genetic context of T-box riboswitch sequences, please enable cookies on your web browser.

Full T-box riboswitch FASTA sequence

>T-box Riboswitch Sequence OP8LOG3 TAATATGACACGTCTGGGACATGCTATAGCTAACGGAAAATTTCAGAGACAGTTGGTAAGGTGTGACAACTGATTTCCTAGTCTTAGTGCTCCCCATTCGGATAATTTGATATTTAACCTTGGGCAACCAAGAAGTAAAGAGGTAAACGAATTCCATCGTTGCAAGCAGAGTGGTACCGCGTCAATCCGGCGTCTCTGATTCGCAATGGTGGTTTTT

Predicted secondary structures

T-box riboswitch OP8LOG3 Antiterminator ......((......((((.........((.(.......(((........((((((...........))))))))).....).))........)))).))...........................................(((.(((........))))))....((((.......(((((.....)))))))))....................

T-box riboswitch OP8LOG3 Terminator ......((......((((.........((.(.......(((........((((((...........))))))))).....).))........)))).))...........................................(((.(((........))))))...........(((((((..((((.(......).)))))))...))))......

Specifier and tRNA predictions

Top specifier

Top predicted specifier: GCU
Top predicted tRNA family: ALA (AGC)

Best tRNA match for top specifier >TBDB tRNA pairing failed
tRNAscan-SE failed to find tRNA in host organism with anticodon matching predicted T-box specifier.

Predicted tRNA structure No tRNA structure predicted.

Alternative specifier 1

Alternative 1 for predicted specifier: -
Alternative 1 for predicted tRNA family: -

Best tRNA match for alternative specifier 1 >TBDB tRNA pairing failed
tRNAscan-SE failed to find tRNA in host organism with anticodon matching predicted T-box specifier.

Predicted tRNA structure No tRNA structure predicted.

Alternative specifier 2

Alternative 2 for predicted specifier: -
Alternative 2 for predicted tRNA family: -

Best tRNA match for alternative specifier 2 >TBDB tRNA pairing failed
tRNAscan-SE failed to find tRNA in host organism with anticodon matching predicted T-box specifier.

Predicted tRNA structure No tRNA structure predicted.

Minimum Free Energy (MFE) Calculations

Folding MFE predictions

Antiterminator	ΔG° (kcal/mol)	-6.4
Terminator	ΔG° (kcal/mol	-6.1
	ΔΔG° (kcal/mol)

*Calculations performed using Vienna RNAeval at 37°C. More information available on methods avaialble on BioRXIV.

INFERNAL T-box riboswitch prediction output

Infernal prediction values

E-Value
Score	42.8
Bias	0.0
CM Accuracy	0.85

*More information about the meaning of these values can be found here.

T-box riboswitch structure prediction from input sequence

Feature	Length	Locus
Stem I		[28,120]
Stem II region
Stem III
Specifier region	-	[109,111]
T-box UGGN locus	-	[193,196]
Antiterminator		[189,218]
Terminator		[196,238]
All stems	-	[[28, 120], [164, 184], [189, 218]]

Input source sequence >CP006603.1:633639-633946
TTTTAAAGTAATTGTTCGCTATAATATGACACGTCTGGGACATGCTATAGCTAACGGAAAATTTCAGAGACAGTTGGTAAGGTGTGACAACTGATTTCCTAGTCTTAGTGCTCCCCATTCGGATAATTTGATATTTAACCTTGGGCAACCAAGAAGTAAAGAGGTAAACGAATTCCATCGTTGCAAGCAGAGTGGTACCGCGTCAATCCGGCGTCTCTGATTCGCAATGGTGGTTTTTGTTTTAGAAAGGGCGATTTGATGAAAGAGTTAAAAAAGCTAAATAGTGCTCAAGTACGGCGGATGTACTT

INFERNAL output sequence >Infernal-CP006603.1:633639-633946
UAAUAUGACACGUCUGGGACAUGCUAUAGCUAACGGAAAAUUUCAGAGACAGUUGGUAAGGUGUGACAACUGAUUUCCUAGUCUUAGU--GCUCCCCA--UUCGGAU-------------------------*[10]*UUAAccuugggcaaCCAAGAAGUAAAGAGGUAAACGAAUUCCAUCGU-UGCAAGCAGAGUGGUACCGCGUCAAUCC-GGCGUCUCUGAU

INFERNAL output structure - (Antiterminator) >Infernal-Structure-CP006603.1:633639-633946
::::::<<------<<<<-------<<<<<<-------<<<--------<<<<<<___________>>>>>>>>>----->>>>>>-------->>>>--->>,,<<<<<<<_____________>>>>>>>~~~~~~,,,,..........,,,,,,,,,,,,,,,<<<<<<<________>>>>>>>,,,,<<<<-------<<<<<______>>>>>>>>>:::