T-box Riboswitch Annotation Database - TBDB - OCDK5N5 from

T-box riboswitch OCDK5N5

Putative PRO (AGG) T-box riboswitch from Bacillus velezensis FZB42

Source information

TBDB ID	OCDK5N5
Host organism	Bacillus velezensis FZB42
Model used	Class I
Predicted regulation	Transcriptional
T-box riboswitch genomic accession	CP000560.1:2275614-2275873
Downstream protein description	pyrroline-5-carboxylate reductase (proC)
Downstream protein ID	GenBank: ABS74554.1
T-box riboswitch length
Specifier loop sequence	CCUGC
T-box 5'-UGGN-3' sequence	UGGU
Predicted specifier	CCU
Predicted tRNA family	PRO (AGG)
Found cognate tRNA	False
Alternative specifiers	None
Metagenome	False
Structural predictions	Full

Genomic Context

Error loading NCBI Genome Browser - Cookies disabled To use the NCBI genome browser for visualizing genetic context of T-box riboswitch sequences, please enable cookies on your web browser.

Full T-box riboswitch FASTA sequence

>T-box Riboswitch Sequence OCDK5N5 CGGAACGCGATGACGAGGAACTAGTATATAAACAACGGCAGCAGAGAGCAATGTCCCCGGCTGAAAGACATTGCGGCCCTCTTGTTTACAGAACCTGCCCTCAGAGCGGTTAGGAAAACCTAAACGTATCCCCTCGTTACGGGATTTGAGCTGAGCACGGCTGATTCGTGCTAATGTAAGGTGGTACCGCGAAACCTTTTCGTCCTTTTTGACGGGAAGGTTTTTTT

Predicted secondary structures

T-box riboswitch OCDK5N5 Antiterminator ......((......((((........(.((((....(((........((((((...............)))))).)))......)))).)........))))...))..(((((....))))).((........)).................(((((((.....))))))).....((((.......((((((...))))))))))....................

T-box riboswitch OCDK5N5 Terminator ......((......((((........(.((((....(((........((((((...............)))))).)))......)))).)........))))...))..(((((....))))).((........)).................(((((((.....)))))))......................((((((((((......)))))))))).......

Specifier and tRNA predictions

Top specifier

Top predicted specifier: CCU
Top predicted tRNA family: PRO (AGG)

Best tRNA match for top specifier >TBDB tRNA pairing failed
tRNAscan-SE failed to find tRNA in host organism with anticodon matching predicted T-box specifier.

Predicted tRNA structure No tRNA structure predicted.

Alternative specifier 1

Alternative 1 for predicted specifier: -
Alternative 1 for predicted tRNA family: -

Best tRNA match for alternative specifier 1 >TBDB tRNA pairing failed
tRNAscan-SE failed to find tRNA in host organism with anticodon matching predicted T-box specifier.

Predicted tRNA structure No tRNA structure predicted.

Alternative specifier 2

Alternative 2 for predicted specifier: -
Alternative 2 for predicted tRNA family: -

Best tRNA match for alternative specifier 2 >TBDB tRNA pairing failed
tRNAscan-SE failed to find tRNA in host organism with anticodon matching predicted T-box specifier.

Predicted tRNA structure No tRNA structure predicted.

Minimum Free Energy (MFE) Calculations

Folding MFE predictions

Antiterminator	ΔG° (kcal/mol)	-4.0
Terminator	ΔG° (kcal/mol	-13.1
	ΔΔG° (kcal/mol)

*Calculations performed using Vienna RNAeval at 37°C. More information available on methods avaialble on BioRXIV.

INFERNAL T-box riboswitch prediction output

Infernal prediction values

E-Value
Score	89.4
Bias	0.0
CM Accuracy	0.88

*More information about the meaning of these values can be found here.

T-box riboswitch structure prediction from input sequence

Feature	Length	Locus
Stem I		[7,107]
Stem II region
Stem III
Specifier region	-	[94,96]
T-box UGGN locus	-	[182,185]
Antiterminator		[178,207]
Terminator		[195,227]
All stems	-	[[7, 107], [110, 123], [125, 136], [154, 172], [178, 207]]

Input source sequence >CP000560.1:2275614-2275873
CGGAACGCGATGACGAGGAACTAGTATATAAACAACGGCAGCAGAGAGCAATGTCCCCGGCTGAAAGACATTGCGGCCCTCTTGTTTACAGAACCTGCCCTCAGAGCGGTTAGGAAAACCTAAACGTATCCCCTCGTTACGGGATTTGAGCTGAGCACGGCTGATTCGTGCTAATGTAAGGTGGTACCGCGAAACCTTTTCGTCCTTTTTGACGGGAAGGTTTTTTTGTGTTTTGGAAAGAAGGAGGATTTATATGAAGA

INFERNAL output sequence >Infernal-CP000560.1:2275614-2275873
CGGAACGCGAUGACGAGGaACUAGUAUAUAAAC---AACGGCAGCAGAGAGCAAUGUCCCcgGCUGAAAgaCAUUGCgGCCCUCuUGUUUACAGAACCUGCCCUCAGAGCGGUUAGG-----------AAAA--CCUAAACGUAUCCCCUCGUUA---CGGGAUUUGAGCuGAGCACGG---CUGAUUCGUGCUAAUgUAAGGUGGUACCGCGAAACCU-UUUCGUCCUUUUU

INFERNAL output structure - (Antiterminator) >Infernal-Structure-CP000560.1:2275614-2275873
::::::<<------<<<<.-------<<<<<<-------<<<--------<<<<<<____.._______..>>>>>>.>>>---.-->>>>>>-------->>>>--->>,,<<<<<<<_____________>>>>>>>,<<<______>>>,,,,,,,,,,,,,,,,,,.,<<<<<<<________>>>>>>>,,,.,<<<<-------<<<<<______>>>>>>>>>:::