T-box Riboswitch Annotation Database - TBDB - NG4Z1TR0 from

T-box riboswitch NG4Z1TR0

Putative TYR (GUA) T-box riboswitch from Clostridium sp. CAG:451

Source information

TBDB ID	NG4Z1TR0
Host organism	Clostridium sp. CAG:451
Model used	Class I
Predicted regulation	Unknown
T-box riboswitch genomic accession	FR901049.1:3195-2961
Downstream protein description	tyrosine--tRNA ligase
Downstream protein ID	ENA: CDE73467.1
T-box riboswitch length
Specifier loop sequence	AUACA
T-box 5'-UGGN-3' sequence	UGGU
Predicted specifier	UAC
Predicted tRNA family	TYR (GUA)
Found cognate tRNA	True
Alternative specifiers	None
Metagenome	False
Structural predictions	Partial

Genomic Context

Error loading NCBI Genome Browser - Cookies disabled To use the NCBI genome browser for visualizing genetic context of T-box riboswitch sequences, please enable cookies on your web browser.

Full T-box riboswitch FASTA sequence

>T-box Riboswitch Sequence NG4Z1TR0 AGATTTCTGTGAAGAATGATAGTAGTTTAGAATAATTATTTAAGAGACTTAGTGGTTGGTGGGAACTAAGATAATGTTTTAGATGAAATACACATTGGGAGAAAGAATCGTGTTAGAGCGTTAATCTATTAAGAGCATAGTTTCTATGAAATAAGGTGGTACCGCGGATGATATCCGTCCTTATATTTGTAGAAACTTTTT

Predicted secondary structures

T-box riboswitch NG4Z1TR0 Antiterminator ......((......((((......((((((......(((........((((((...........))))))))).....))))))........))))...)).......(((......)))...............(((((...)))))....((((.......((((((...))))))))))...................

T-box riboswitch NG4Z1TR0 Terminator Error: TBDB structure refinement failed to predict a terminator structure for this T-box

Specifier and tRNA predictions

Top specifier

Top predicted specifier: UAC
Top predicted tRNA family: TYR (GUA)

Best tRNA match for top specifier >TYR (GUA) tRNA from Clostridium sp. CAG:451
GGAGAGGTAGCGAAGTGGCTAAACGCGACAGACTGTAAATCTGTTCCTTCGGGTTCGATGGTTCGAATCCATCTCTCTCCACCA

Predicted tRNA structure (((((((..(((...........))).(((((.......))))).((....))...(((((.......))))))))))))....

Alternative specifier 1

Alternative 1 for predicted specifier: -
Alternative 1 for predicted tRNA family: -

Best tRNA match for alternative specifier 1 >TBDB tRNA pairing failed
tRNAscan-SE failed to find tRNA in host organism with anticodon matching predicted T-box specifier.

Predicted tRNA structure No tRNA structure predicted.

Alternative specifier 2

Alternative 2 for predicted specifier: -
Alternative 2 for predicted tRNA family: -

Best tRNA match for alternative specifier 2 >TBDB tRNA pairing failed
tRNAscan-SE failed to find tRNA in host organism with anticodon matching predicted T-box specifier.

Predicted tRNA structure No tRNA structure predicted.

Minimum Free Energy (MFE) Calculations

Folding MFE predictions

Antiterminator	ΔG° (kcal/mol)	-7.2
Terminator	ΔG° (kcal/mol	-5.9
	ΔΔG° (kcal/mol)

*Calculations performed using Vienna RNAeval at 37°C. More information available on methods avaialble on BioRXIV.

INFERNAL T-box riboswitch prediction output

Infernal prediction values

E-Value
Score	107.7
Bias	8.3
CM Accuracy	0.97

*More information about the meaning of these values can be found here.

T-box riboswitch structure prediction from input sequence

Feature	Length	Locus
Stem I		[7,101]
Stem II region
Stem III
Specifier region	-	[88,90]
T-box UGGN locus	-	[157,160]
Antiterminator		[153,182]
Terminator		[164,201]
All stems	-	[[7, 101], [109, 120], [136, 148], [153, 182]]

Input source sequence >FR901049.1:3195-2961
AGATTTCTGTGAAGAATGATAGTAGTTTAGAATAATTATTTAAGAGACTTAGTGGTTGGTGGGAACTAAGATAATGTTTTAGATGAAATACACATTGGGAGAAAGAATCGTGTTAGAGCGTTAATCTATTAAGAGCATAGTTTCTATGAAATAAGGTGGTACCGCGGATGATATCCGTCCTTATATTTGTAGAAACTTTTT

INFERNAL output sequence >Infernal-FR901049.1:3195-2961
AGAUUUCUGUGAAGAAUG-AUAGUAGUUUAGAA-UAAUUAUUUAAGAGACUUAGUGGUUGGUGGGAACUAAGAUAAUGUUUUAGAUGAAAUACACAUUGGGAGAA----------------AGAA-------UCGUGUUAGAGCGUUA----AUCUAUUAAGAGCAUAGU-------UU--CUAUGAAAUAAGGUGGUACCGCGGAUGAUA-UCCGUCCUUAUA

INFERNAL output structure - (Antiterminator) >Infernal-Structure-FR901049.1:3195-2961
::::::<<------<<<<-------<<<<<<-------<<<--------<<<<<<___________>>>>>>>>>----->>>>>>-------->>>>--->>,,<<<<<<<_____________>>>>>>>,<<<______>>>,,,,,,,,,,,,,,,,,,,<<<<<<<________>>>>>>>,,,,<<<<-------<<<<<______>>>>>>>>>:::