T-box Riboswitch Annotation Database - TBDB - KB4Q4SZ4 from - Pontibacillus marinus BH030004 = DSM 16465

T-box riboswitch KB4Q4SZ4

Putative TYR (GUA) T-box riboswitch from Pontibacillus marinus BH030004 = DSM 16465

Source information

TBDB ID	KB4Q4SZ4
Host organism	Pontibacillus marinus BH030004 = DSM 16465
Model used	Class I
Predicted regulation	Transcriptional
T-box riboswitch genomic accession	AVPF01000062.1:16592-16332
Downstream protein description	tyrosyl-tRNA synthase
Downstream protein ID	GenBank: KGX84239.1
T-box riboswitch length
Specifier loop sequence	UUACG
T-box 5'-UGGN-3' sequence	UGGU
Predicted specifier	UAC
Predicted tRNA family	TYR (GUA)
Found cognate tRNA	True
Alternative specifiers	None
Metagenome	False
Structural predictions	Full

Genomic Context

Error loading NCBI Genome Browser - Cookies disabled To use the NCBI genome browser for visualizing genetic context of T-box riboswitch sequences, please enable cookies on your web browser.

Full T-box riboswitch FASTA sequence

>T-box Riboswitch Sequence KB4Q4SZ4 TATTGAGCGTTGAAGGGTTGCAGTAATGATTTGTTTTCTGATTTTAGAGAGCTGACGGTTGGTGAAAGTCAGTACAGAACAAATTGTGAATTACGTCCTGGAGTATCTTCTGCGAAATCAGAAGACGGTTAAAAACCGTTATTTTTTCCGAGTGGTAACAAGATTTCTTGTTACAACAAGGGTGGTACCGCGATCAAACCTCGTCCCTTTTTTATGTAGGGCGGGGTTTTTT

Predicted secondary structures

T-box riboswitch KB4Q4SZ4 Antiterminator ......((......(((........((((((.......((.(........((((((...........))))))))).....)))))).........)))...))..((((((......)))))).(((.......)))................(((((((......)))))))....((((.......((((.......))))))))........................

T-box riboswitch KB4Q4SZ4 Terminator ......((......(((........((((((.......((.(........((((((...........))))))))).....)))))).........)))...))..((((((......)))))).(((.......)))................(((((((......)))))))........................(((((.((((.........)))))))))......

Specifier and tRNA predictions

Top specifier

Top predicted specifier: UAC
Top predicted tRNA family: TYR (GUA)

Best tRNA match for top specifier >TYR (GUA) tRNA from Pontibacillus marinus BH030004 = DSM 16465
GGAGGGATAGCGAAGTTGGCCAAACGCGGCGGACTGTAAATCCGCTCCCTCTGGGTTCGCAGGTTCGAGTCCTGCTCCCTCCACCA

Predicted tRNA structure (((((((..(((............))).(((((.......))))).(((...)))...(((((.......))))))))))))....

Alternative specifier 1

Alternative 1 for predicted specifier: -
Alternative 1 for predicted tRNA family: -

Best tRNA match for alternative specifier 1 >TBDB tRNA pairing failed
tRNAscan-SE failed to find tRNA in host organism with anticodon matching predicted T-box specifier.

Predicted tRNA structure No tRNA structure predicted.

Alternative specifier 2

Alternative 2 for predicted specifier: -
Alternative 2 for predicted tRNA family: -

Best tRNA match for alternative specifier 2 >TBDB tRNA pairing failed
tRNAscan-SE failed to find tRNA in host organism with anticodon matching predicted T-box specifier.

Predicted tRNA structure No tRNA structure predicted.

Minimum Free Energy (MFE) Calculations

Folding MFE predictions

Antiterminator	ΔG° (kcal/mol)	-5.5
Terminator	ΔG° (kcal/mol	-13.2
	ΔΔG° (kcal/mol)

*Calculations performed using Vienna RNAeval at 37°C. More information available on methods avaialble on BioRXIV.

INFERNAL T-box riboswitch prediction output

Infernal prediction values

E-Value
Score	137.8
Bias	0.0
CM Accuracy	0.98

*More information about the meaning of these values can be found here.

T-box riboswitch structure prediction from input sequence

Feature	Length	Locus
Stem I		[7,104]
Stem II region
Stem III
Specifier region	-	[91,93]
T-box UGGN locus	-	[183,186]
Antiterminator		[179,208]
Terminator		[199,232]
All stems	-	[[7, 104], [107, 124], [126, 138], [155, 174], [179, 208]]

Input source sequence >AVPF01000062.1:16592-16332
TATTGAGCGTTGAAGGGTTGCAGTAATGATTTGTTTTCTGATTTTAGAGAGCTGACGGTTGGTGAAAGTCAGTACAGAACAAATTGTGAATTACGTCCTGGAGTATCTTCTGCGAAATCAGAAGACGGTTAAAAACCGTTATTTTTTCCGAGTGGTAACAAGATTTCTTGTTACAACAAGGGTGGTACCGCGATCAAACCTCGTCCCTTTTTTATGTAGGGCGGGGTTTTTT

INFERNAL output sequence >Infernal-AVPF01000062.1:16592-16332
UAUUGAGCGUUGAAGGGUUGCAGUAAUGAUUUGUUUUCUGaUUUUAGAGAGCUGACGGUUGGUGAAAGUCAGUACAGAACAAAUUGUGAAUUACGUCCUGGAGUAUCUUCUGCGAA---------AUCAGAAGACGGUUAAaAACCGUUA---UUUUUUCCGAGUGGUAACAAG--AUUUCUUGUUACAACAAGGGUGGUACCGCGAUCAAAC-CUCGUCCCUUUU

INFERNAL output structure - (Antiterminator) >Infernal-Structure-AVPF01000062.1:16592-16332
::::::<<------<<<<-------<<<<<<-------<<.<--------<<<<<<___________>>>>>>>>>----->>>>>>-------->>>>--->>,,<<<<<<<_____________>>>>>>>,<<<____.__>>>,,,,,,,,,,,,,,,,,,,<<<<<<<________>>>>>>>,,,,<<<<-------<<<<<______>>>>>>>>>:::