T-box Riboswitch Annotation Database - TBDB - KAZ6JLB1 from

T-box riboswitch KAZ6JLB1

Putative ALA (UGC) T-box riboswitch from Clostridiales bacterium 38-18

Source information

TBDB ID	KAZ6JLB1
Host organism	Clostridiales bacterium 38-18
Model used	Class I
Predicted regulation	Transcriptional
T-box riboswitch genomic accession	MKTL01000024.1:102536-102280
Downstream protein description	alanine--tRNA ligase
Downstream protein ID	GenBank: OJV62125.1
T-box riboswitch length
Specifier loop sequence	AGCAG
T-box 5'-UGGN-3' sequence	UGGU
Predicted specifier	GCA
Predicted tRNA family	ALA (UGC)
Found cognate tRNA	False
Alternative specifiers	None
Metagenome	False
Structural predictions	Full

Genomic Context

Error loading NCBI Genome Browser - Cookies disabled To use the NCBI genome browser for visualizing genetic context of T-box riboswitch sequences, please enable cookies on your web browser.

Full T-box riboswitch FASTA sequence

>T-box Riboswitch Sequence KAZ6JLB1 TAACAGGCATAGACGAAGAGGAGTAGATTCAACGATAGAGAGCGTATGTGTGGTGGAAATGCGCAAGAATCGAAGCAGCTTCCGAGCCCATTTTCTGAACGGATAGTAGGAAAGTGCGTTTTGCAAACGTTAAGATGCAGTTTAACCTTCAAAGTGATTGGGCGTTGTCCAATAAGTAGGGTGGTACCGCGATAAGTCGTCCCTACACATTCTTTGGAGGTTTTTTT

Predicted secondary structures

T-box riboswitch KAZ6JLB1 Antiterminator ......((......((((.......(((((...........((((((...........))))))..))))).......))))...))..(((((((............))))))).(((.......)))...........................(((((((...)))))))....((((.......((((....)))))))).......................

T-box riboswitch KAZ6JLB1 Terminator ......((......((((.......(((((...........((((((...........))))))..))))).......))))...))..(((((((............))))))).(((.......)))...........................(((((((...)))))))............................(((.(.((.....)))))).......

Specifier and tRNA predictions

Top specifier

Top predicted specifier: GCA
Top predicted tRNA family: ALA (UGC)

Best tRNA match for top specifier >TBDB tRNA pairing failed
tRNAscan-SE failed to find tRNA in host organism with anticodon matching predicted T-box specifier.

Predicted tRNA structure No tRNA structure predicted.

Alternative specifier 1

Alternative 1 for predicted specifier: -
Alternative 1 for predicted tRNA family: -

Best tRNA match for alternative specifier 1 >TBDB tRNA pairing failed
tRNAscan-SE failed to find tRNA in host organism with anticodon matching predicted T-box specifier.

Predicted tRNA structure No tRNA structure predicted.

Alternative specifier 2

Alternative 2 for predicted specifier: -
Alternative 2 for predicted tRNA family: -

Best tRNA match for alternative specifier 2 >TBDB tRNA pairing failed
tRNAscan-SE failed to find tRNA in host organism with anticodon matching predicted T-box specifier.

Predicted tRNA structure No tRNA structure predicted.

Minimum Free Energy (MFE) Calculations

Folding MFE predictions

Antiterminator	ΔG° (kcal/mol)	-5.6
Terminator	ΔG° (kcal/mol	-2.1
	ΔΔG° (kcal/mol)

*Calculations performed using Vienna RNAeval at 37°C. More information available on methods avaialble on BioRXIV.

INFERNAL T-box riboswitch prediction output

Infernal prediction values

E-Value
Score	111.2
Bias	0.0
CM Accuracy	0.97

*More information about the meaning of these values can be found here.

T-box riboswitch structure prediction from input sequence

Feature	Length	Locus
Stem I		[7,87]
Stem II region
Stem III
Specifier region	-	[74,76]
T-box UGGN locus	-	[182,185]
Antiterminator		[178,204]
Terminator		[202,227]
All stems	-	[[7, 87], [90, 115], [117, 129], [157, 173], [178, 204]]

Input source sequence >MKTL01000024.1:102536-102280
TAACAGGCATAGACGAAGAGGAGTAGATTCAACGATAGAGAGCGTATGTGTGGTGGAAATGCGCAAGAATCGAAGCAGCTTCCGAGCCCATTTTCTGAACGGATAGTAGGAAAGTGCGTTTTGCAAACGTTAAGATGCAGTTTAACCTTCAAAGTGATTGGGCGTTGTCCAATAAGTAGGGTGGTACCGCGATAAGTCGTCCCTACACATTCTTTGGAGGTTTTTTT

INFERNAL output sequence >Infernal-MKTL01000024.1:102536-102280
UAACAGGCAUAGACGAAGAGGAGUAGAUUCAAC--GA------UAGAGAGCGUAUGUGUGGUGGAAAUGCGC-------AAGAAUCGAA-GCAGCUUCCGAGCCCAUUUUCUGAA-CGGAUAGUAGGAAAGUGCGUUUUGcAAACGUUAAgaugcaguUUAACCUUCAAAGUGAUUGGGC-----GUUGUCCAAUAAGUAGGGUGGUACCGCGAU---AA-GUCGUCCCUACA

INFERNAL output structure - (Antiterminator) >Infernal-Structure-MKTL01000024.1:102536-102280
::::::<<------<<<<-------<<<<<<-------<<<--------<<<<<<___________>>>>>>>>>----->>>>>>-------->>>>--->>,,<<<<<<<_____________>>>>>>>,<<<____.__>>>,,,,........,,,,,,,,,,,,,,,<<<<<<<________>>>>>>>,,,,<<<<-------<<<<<______>>>>>>>>>:::