T-box Riboswitch Annotation Database - TBDB - DTHUZBQL from - Enterococcus saccharolyticus subsp. saccharolyticus ATCC 43076

T-box riboswitch DTHUZBQL

Putative MET (CAU) T-box riboswitch from Enterococcus saccharolyticus subsp. saccharolyticus ATCC 43076

Source information

TBDB ID	DTHUZBQL
Host organism	Enterococcus saccharolyticus subsp. saccharolyticus ATCC 43076
Model used	Class I
Predicted regulation	Unknown
T-box riboswitch genomic accession	KE136389.1:379462-379747
Downstream protein description	hypothetical protein
Downstream protein ID	GenBank: EOT30669.1
T-box riboswitch length
Specifier loop sequence	AAUGG
T-box 5'-UGGN-3' sequence	UGGU
Predicted specifier	AUG
Predicted tRNA family	MET (CAU)
Found cognate tRNA	True
Alternative specifiers	AAU,UGG
Metagenome	False
Structural predictions	Partial

Genomic Context

Error loading NCBI Genome Browser - Cookies disabled To use the NCBI genome browser for visualizing genetic context of T-box riboswitch sequences, please enable cookies on your web browser.

Full T-box riboswitch FASTA sequence

>T-box Riboswitch Sequence DTHUZBQL TAAAATTCAATGAAGAGAAAAGTACACTTCGCAAATTTTAAGAGAGGTTCTGGATGGTGCAAAGAACTAATTTAATAAGTAGAAAAATGGTCTCTGAGAAAAACTGTTGATAAGTAAGCAGTTTCGGAAAAGTTCATCCGTTATATTTGAACGCCAATCTCATGATAGATGATGTTGGACAAAGAGAAGTGCAAGCTTCTAAACAAAGGTGGTACCGCGATATATTCGCCCTTTTACTGGTTTTTTTAACTGGTAAAAGGGCTTTTTTT

Predicted secondary structures

T-box riboswitch DTHUZBQL Antiterminator ......((......((((......(((((.....(((........((((((...........))))))))).....)))).)........))))...))..(((((((........))))))).(((..........)))............................................((((((....)))))).....((((.......((((.....))))))))....................................

T-box riboswitch DTHUZBQL Terminator Error: TBDB structure refinement failed to predict a terminator structure for this T-box

Specifier and tRNA predictions

Top specifier

Top predicted specifier: AUG
Top predicted tRNA family: MET (CAU)

Best tRNA match for top specifier >MET (CAU) tRNA from Enterococcus saccharolyticus subsp. saccharolyticus ATCC 43076
CGCGGTGTAGCTCAGCTGGCTAGAGCGTCCGGTTCATACCCGGGAGGTCGGGGGTTCGATCCCCTCCGCCGCGACCA

Predicted tRNA structure (((((((..((((.........)))).(((((.......))))).....(((((.......))))))))))))....

Alternative specifier 1

Alternative 1 for predicted specifier: AAU
Alternative 1 for predicted tRNA family: ASN (AUU)

Best tRNA match for alternative specifier 1 >TBDB tRNA pairing failed
tRNAscan-SE failed to find tRNA in host organism with anticodon matching predicted T-box specifier.

Predicted tRNA structure No tRNA structure predicted.

Alternative specifier 2

Alternative 2 for predicted specifier: UGG
Alternative 2 for predicted tRNA family: ASN (CCA)

Best tRNA match for alternative specifier 2 >ASN (CCA) tRNA from Enterococcus saccharolyticus subsp. saccharolyticus ATCC 43076
AGGGGCATAGTTTAAAGGTAGAACAACGGTCTCCAAAACCGTTGGTGTGGGTTCAATTCCTGCTGCCCCTGCCA

Predicted tRNA structure (((((((..((((.......)))).(((((.......)))))....(((((.......))))))))))))....

Minimum Free Energy (MFE) Calculations

Folding MFE predictions

Antiterminator	ΔG° (kcal/mol)	-5.0
Terminator	ΔG° (kcal/mol	-21.9
	ΔΔG° (kcal/mol)

*Calculations performed using Vienna RNAeval at 37°C. More information available on methods avaialble on BioRXIV.

INFERNAL T-box riboswitch prediction output

Infernal prediction values

E-Value
Score	117.9
Bias	4.3
CM Accuracy	0.94

*More information about the meaning of these values can be found here.

T-box riboswitch structure prediction from input sequence

Feature	Length	Locus
Stem I		[7,99]
Stem II region
Stem III
Specifier region	-	[86,88]
T-box UGGN locus	-	[210,213]
Antiterminator		[206,233]
Terminator		[228,269]
All stems	-	[[7, 99], [102, 123], [125, 140], [185, 200], [206, 233]]

Input source sequence >KE136389.1:379462-379747
TAAAATTCAATGAAGAGAAAAGTACACTTCGCAAATTTTAAGAGAGGTTCTGGATGGTGCAAAGAACTAATTTAATAAGTAGAAAAATGGTCTCTGAGAAAAACTGTTGATAAGTAAGCAGTTTCGGAAAAGTTCATCCGTTATATTTGAACGCCAATCTCATGATAGATGATGTTGGACAAAGAGAAGTGCAAGCTTCTAAACAAAGGTGGTACCGCGATATATTCGCCCTTTTACTGGTTTTTTTAACTGGTAAAAGGGCTTTTTTT

INFERNAL output sequence >Infernal-KE136389.1:379462-379747
UAAAAUUCAAUGAAGAGA-AAAGUAC-ACUUCG--CAAAUUUUAAGAGAGGUUCUGGAUGGUGCAAAGAACUAAUUUAAUAAGUAGAAAAAUGGUCUCUGAGAAAAACUGUUGAU-----AAGUAAGCAGUUUCGGAAAAguucAUCCGUUAUauuugaacgccaaucucaugauagaUGAUGUUGGACAAAGAGAAGUG------CAAGCUUCUAAAcAAAGGUGGUACCGCGAU--AUA-UUCGCCCUUUUA

INFERNAL output structure - (Antiterminator) >Infernal-Structure-KE136389.1:379462-379747
::::::<<------<<<<-------<<<<<<-------<<<--------<<<<<<___________>>>>>>>>>----->>>>>>-------->>>>--->>,,<<<<<<<_____________>>>>>>>,<<<____....__>>>,,,,.........................,,,,,,,,,,,,,,,<<<<<<<________>>>>>>>,,,.,<<<<-------<<<<<______>>>>>>>>>:::