T-box Riboswitch Annotation Database - TBDB - BNERALZ from

T-box riboswitch BNERALZ

Putative PRO (AGG) T-box riboswitch from Streptococcus sobrinus TCI-157

Source information

TBDB ID	BNERALZ
Host organism	Streptococcus sobrinus TCI-157
Model used	Class I
Predicted regulation	Transcriptional
T-box riboswitch genomic accession	AGHO01001298.1:1330-1586
Downstream protein description	-
Downstream protein ID	-
T-box riboswitch length
Specifier loop sequence	ACCUG
T-box 5'-UGGN-3' sequence	UGGU
Predicted specifier	CCU
Predicted tRNA family	PRO (AGG)
Found cognate tRNA	False
Alternative specifiers	ACC,CUG
Metagenome	False
Structural predictions	Full

Genomic Context

Error loading NCBI Genome Browser - Cookies disabled To use the NCBI genome browser for visualizing genetic context of T-box riboswitch sequences, please enable cookies on your web browser.

Full T-box riboswitch FASTA sequence

>T-box Riboswitch Sequence BNERALZ CGAAGCGAAAGGATTAGTATGTGAGAACCTTTCATAAAAGAGAGTGAAGTTTATAAGCTGAAAGACTTCATAATGAAAGAACACAGAACCTGCCTCTCAAGTCCTACTACAGTAGGCGCATTTCTTGCGTTATCAGACAAAGTGGAATCAATATTTATATTGGTTCAATTAAGGTGGTACCACGGAAAGCTCATTTTCGTCCTTTTAATAGGATGAAAATGAGCTTTTTT

Predicted secondary structures

T-box riboswitch BNERALZ Antiterminator ......((.(((.......((((.........(((........((((((................)))))).)))......)))).......))).))....(((((....)))))(((.......)))...............(((((((........)))))))....((((.......(((((((.....)))))))))))..........................

T-box riboswitch BNERALZ Terminator ......((.(((.......((((.........(((........((((((................)))))).)))......)))).......))).))....(((((....)))))(((.......)))...............(((((((........)))))))......................(((((((((((((((......)))))))))))))))......

Specifier and tRNA predictions

Top specifier

Top predicted specifier: CCU
Top predicted tRNA family: PRO (AGG)

Best tRNA match for top specifier >TBDB tRNA pairing failed
tRNAscan-SE failed to find tRNA in host organism with anticodon matching predicted T-box specifier.

Predicted tRNA structure No tRNA structure predicted.

Alternative specifier 1

Alternative 1 for predicted specifier: ACC
Alternative 1 for predicted tRNA family: THR (GGU)

Best tRNA match for alternative specifier 1 >TBDB tRNA pairing failed
tRNAscan-SE failed to find tRNA in host organism with anticodon matching predicted T-box specifier.

Predicted tRNA structure No tRNA structure predicted.

Alternative specifier 2

Alternative 2 for predicted specifier: CUG
Alternative 2 for predicted tRNA family: THR (CAG)

Best tRNA match for alternative specifier 2 >TBDB tRNA pairing failed
tRNAscan-SE failed to find tRNA in host organism with anticodon matching predicted T-box specifier.

Predicted tRNA structure No tRNA structure predicted.

Minimum Free Energy (MFE) Calculations

Folding MFE predictions

Antiterminator	ΔG° (kcal/mol)	-5.5
Terminator	ΔG° (kcal/mol	-23.3
	ΔΔG° (kcal/mol)

*Calculations performed using Vienna RNAeval at 37°C. More information available on methods avaialble on BioRXIV.

INFERNAL T-box riboswitch prediction output

Infernal prediction values

E-Value
Score	95.0
Bias	0.0
CM Accuracy	0.89

*More information about the meaning of these values can be found here.

T-box riboswitch structure prediction from input sequence

Feature	Length	Locus
Stem I		[7,98]
Stem II region
Stem III
Specifier region	-	[88,90]
T-box UGGN locus	-	[175,178]
Antiterminator		[171,204]
Terminator		[189,230]
All stems	-	[[7, 98], [103, 116], [117, 129], [145, 166], [171, 204]]

Input source sequence >AGHO01001298.1:1330-1586
CGAAGCGAAAGGATTAGTATGTGAGAACCTTTCATAAAAGAGAGTGAAGTTTATAAGCTGAAAGACTTCATAATGAAAGAACACAGAACCTGCCTCTCAAGTCCTACTACAGTAGGCGCATTTCTTGCGTTATCAGACAAAGTGGAATCAATATTTATATTGGTTCAATTAAGGTGGTACCACGGAAAGCTCATTTTCGTCCTTTTAATAGGATGAAAATGAGCTTTTTTAATTGGGTGTATTCGGAGTAACTTAGT

INFERNAL output sequence >Infernal-AGHO01001298.1:1330-1586
CGAAGCGA------AAGGAUUAGUAUGUGAGAACCUUUCAUAAAAGAGAGUGAAGUUUAuaaGCUGAAAgaCUUCAUaAUGAAA-GAACACAGAA-CCUGCCUC---UCAagUCCUACU*[ 2]*AGUAGG-CGCAUUUcUUGCGUUA----UCAGACAAAGUGGAAUCAAUAUUUAUAUUGGUUCAAUUAAGGUGGUACCACGGAAag--CUcauUUUCGUCCUUUUA

INFERNAL output structure - (Antiterminator) >Infernal-Structure-AGHO01001298.1:1330-1586
::::::<<------<<<<-------<<<<<<-------<<<--------<<<<<<____..._______..>>>>>>.>>>----->>>>>>-------->>>>--->>,..,<<<<<<~~~~~~>>>>>>,<<<____.__>>>,,,,,,,,,,,,,,,,,,,<<<<<<<________>>>>>>>,,,,<<<<-------<<<<<_..____..._>>>>>>>>>:::